Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GlvR in Staphylococcaceae

Properties
Regulator family: RpiR
Regulation mode: activator
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Regulog: GlvR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA2114 glvC -181 7.6 TGAAAAAATTTTCACTATATGAAAA
Staphylococcus capitis SK14
STACA0001_1166 glvC -190 7.3 TGAAAAAATTTCCGTTCAATGAAAA
Staphylococcus epidermidis ATCC 12228
SE1897 glvC -181 7.6 TGAAAATATTTTCTTTATATGAAAA
Staphylococcus haemolyticus JCSC1435
SH0732 glvC -198 7.4 TGAAAATATTTTCATGTATAGAAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP0583 glvC -193 7.4 TGAAAATATTTTCAACTTTTGAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD