Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BDP_1267 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BDP_1267 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium breve DSM 20213
BIFBRE_00098 BDP_1267 -226 6 TCATTAGAACGTTCAAATAA
BIFBRE_00099 BDP_1268 -86 6 TTATTTGAACGTTCTAATGA
Bifidobacterium dentium Bd1
BDP_1267 BDP_1267 -210 5.8 TAATTAGAACGTTCTAATTT
BDP_1268 BDP_1268 -50 5.8 AAATTAGAACGTTCTAATTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD