Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR1 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR1 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium dentium Bd1
BDP_0172 rbsA -41 6.9 GTGCGGTAACGTTGCCGCAC
BDP_0171 rbsR1 -232 6.6 TTGTGGTAACGTTACCGCAT
BDP_0171 rbsR1 -187 7 ATGAGGTAACGTTACCGCAT
Gardnerella vaginalis 409-05
HMPREF0424_1339 rbsR1 -237 5.1 TTGTGGGAACGTTATCTCAA
HMPREF0424_1339 rbsR1 -281 7.1 TTGCGGTAACGTTACCGCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD