Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HxlR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Hexulose metabolism
Effector:
Regulog: HxlR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium angulatum DSM 20098
BIFANG_01235 hxlP -83 5.5 AAACGTAACCGGTAAACTAA
BIFANG_01235 hxlP -96 5.6 GTTGTTAACCGATAAACGTA
BIFANG_01235 hxlP -131 5.5 GTAGTTAACCGGTACACATG
Bifidobacterium dentium Bd1
BDP_0010 hxlP -97 6.3 ATAGTTAACCGGTAAACGAA
BDP_0010 hxlP -132 6.3 GTAGTTAACCGGTAAACAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD