Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CscR in Bifidobacteria

Properties
Regulator family: LacI
Regulation mode:
Biological process: Sucrose utilization
Effector: Sucrose
Regulog: CscR - Bifidobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_0788 cscB -134 7.1 GACGTCAATCGATTGACGTA
Blon_0788 cscB -120 6.8 GACGTAAATCGATTGACGTC
Bifidobacterium adolescentis ATCC 15703
BAD_1149 cscB -70 6.4 GACGTCAAACGATTGACGAA
BAD_1149 cscB -84 7 GACGTCAAACGATTGACGTC
Bifidobacterium angulatum DSM 20098
BIFANG_01828 cscB -12 6 GACGTAAATCGATTGACGCT
BIFANG_01828 cscB -26 7.1 TACGTCAATCGATTGACGTA
Bifidobacterium animalis subsp. lactis AD011
BLA_0818 cscB -217 6.3 GAAGTCAATCGTTTGATGTC
Bifidobacterium breve DSM 20213
BIFBRE_00577 cscB -114 6.8 GACGTAAATCGATTGACGTC
BIFBRE_00577 cscB -128 7.1 GACGTCAATCGATTGACGTA
Bifidobacterium dentium Bd1
BDP_1602 cscB -158 6.5 GGCGTCAATCGATTTACGTC
BDP_1602 cscB -144 6.8 TACGTCAATCGATTGACGTG
Bifidobacterium gallicum DSM 20093
BIFGAL_00341 cscB -167 6.1 AACGTCAATCGTTTGACGCA
BIFGAL_00341 cscB -121 6.6 TGCGTCAATCGTTTGACGTC
BIFGAL_00341 cscB -107 6.2 GACGTCAAACGTTTGACGCG
Bifidobacterium longum NCC2705
BL0106 cscB -134 7.1 TACGTCAATCGATTGACGTA
BL0106 cscB -120 6.8 GACGTAAATCGATTGACGTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD