Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GosR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Galactooligosaccharide utilization; Galactan utilization
Effector: Galactobiose
Regulog: GosR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_1405 gosB2 -159 5.3 CAGGTACACAGTTATACCAA
BAD_1401 bgaB -60 6.1 ATGCTACACCGGTGTACCAC
BAD_1405 gosB2 -190 4.9 ATGGTACACCGGAAAACCTA
Bifidobacterium angulatum DSM 20098
BIFANG_00156 bgaB 17 5.9 GTGGTACAACTGTGTATCAT
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100001412 null -39 4.9 CTGGTATAGCGGTGCATCAT
BbifN4_010100001412 null -11 6.1 TTGATACTCCGTTGTATCAA
Bifidobacterium breve DSM 20213
BIFBRE_02223 gosB -260 6.3 TTGGTACACAGGTGTATCAT
BIFBRE_02223 gosB -232 5.6 TTGGTACATGGGTGTACCAA
Bifidobacterium dentium Bd1
BDP_1911 gosB -216 5.9 TTGATACAGCTGTGTATCAT
BDP_1911 gosB -188 5.8 ATGATACACAGTTGTATCAG
BDP_1911 gosB -98 6 TTGGTACAGCGGTATATCAA
BDP_2054 galA -29 5.8 TTGGTACAACGGTGTCTCTA
BDP_1908 bgaB -72 6.2 TTGCTACACCGTTGTATCAT
Bifidobacterium longum NCC2705
BL0257 galA -97 5 GTGGTACACAGCTGTACCGC
BL0262 gosB -253 6.1 TTGGTACACGGGTGTACCAA
BL0262 gosB -281 6.3 TTGGTACACAGGTGTATCAT
BL0257 galA -147 5.8 TTGATACACCGGTTGACCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD