Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BL0185 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BL0185 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_0152 abfA2 -49 4.7 TATATTCAACGTTGTAAATA
BAD_0153 null -267 4.7 AAATTACAACGTTGAAAATA
BAD_0152 abfA2 -72 5.5 TTGTTACAACGATGTAAGAA
BAD_0146 null -72 6.3 GTTGTACAACGATGTAAAAC
BAD_0153 null -299 5.8 GTTGTACAACGATAGAAAAA
BAD_0146 null -47 5.9 ATAGTACATCGTTGTAAAAC
Bifidobacterium angulatum DSM 20098
BIFANG_01256 null -43 5 ATAATACATCGATGTAAATC
BIFANG_01259 null -114 5.1 AAATTACAACGTTATAAAAG
BIFANG_01259 null -146 5.7 CTTGTACAACGATAGAAAAA
BIFANG_01258 abfA2 -49 4.7 TATATTCAACGTTGTAAATA
BIFANG_01258 abfA2 -72 5.6 TTGTTACAACGTTGTAAGAA
BIFANG_01256 null -69 6 GCTGTACAACGATGTAAAAA
Bifidobacterium dentium Bd1
BDP_0237 null -44 5.4 ATAGTACATCGTTGTAAATG
BDP_0237 null -69 6.1 TTTGTACAACGTTGTAATAT
BDP_0240 null -170 5.9 TTTGTACAACGATAGAAAAA
BDP_0239 abfA2 -50 4.5 TATATTCAACGTTGTAAATT
BDP_0239 abfA2 -73 5.9 TTTGTACAACGATGTAATAG
BDP_0236 null -58 6.1 ATATTACAACGTTGTACAAA
BDP_0236 null -83 5.4 CATTTACAACGATGTACTAT
Bifidobacterium longum NCC2705
BL0186 null -207 5.5 GATGTACAACGATGTAACAA
BL0187 abfA2 -77 5.5 TTGTTACATCGTTGTACATC
BL0188 null -175 4.9 GAATTCCAACGTTGTAAACG
BL0186 null -65 4.7 GAATTACAACGTTATAATGA
BL0188 null -205 6.1 TTTGTACAACGATGGAAAAC
BL0187 abfA2 -53 5 ATATTGCATCGATGTAAATA
BL0183 null -62 6 AGTTTACATCGTTGTACAAA
BL0186 null -231 5 TATTTACATCGATGCAATAT
BL0184 null -73 6 TTTGTACAACGATGTAAACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD