Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BLA_0143 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BLA_0143 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_1905 null -161 5 CGACTTAACCGCTTCAGATT
Bifidobacterium angulatum DSM 20098
BIFANG_00310 BLA_0143 -41 4.3 TGGCTGAAGCGCTTCTTGCA
Bifidobacterium animalis subsp. lactis AD011
BLA_0142 bmnA -134 5.6 GAACTTAAGCGCTTGATAAA
BLA_0147 null -199 5.7 CGACTTAAGCGCTTCAGTGA
BLA_0145 SSF53850 -224 5.9 TATATTAAGCGGTTAAGTCA
Bifidobacterium dentium Bd1
BDP_1538 null -88 5.7 TGCATTAACCGCTTAAGTGA
BDP_0125 null -162 5.4 CAACTTAAGCGCTTGACAAA
BDP_0124 null -30 5.7 TATCTTAACCGCTTCAGGAA
BDP_0129 BLA_0143 -44 5.1 TTAAGTAATCGCTTAAGTTC
BDP_0133 SSF53850 -98 6 TATATTAAGCGCTTAAGTAG
BDP_0134 null -110 6 CTACTTAAGCGCTTAATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD