Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AbfR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Arabinose oligosaccharide utilization
Effector:
Regulog: AbfR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium animalis subsp. lactis AD011
BLA_0055 abfA -113 6.6 GAAGTACAAGGTTGTACTAG
Bifidobacterium longum NCC2705
BL0544 abfA -131 6.6 TCAGTACAAGGTTGTACTAC
BL1611 abfA -153 6.4 GAAGTACAAGGTTGTATTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD