Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Staphylococcaceae

Properties
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Regulog: FruR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0653 fruR -83 4.9 TGGGTGTTTGTGATTGTTTT
SA0653 fruR -73 5.3 TGATTGTTTTTGGTAATTTA
SA0653 fruR -63 5.6 TGGTAATTTATGATTGAAAA
Staphylococcus capitis SK14
STACA0001_0331 fruR -76 5.4 TGATTGTTTGTGATAATTTA
STACA0001_0331 fruR -66 5.9 TGATAATTTATGATTGAAAA
STACA0001_0331 fruR -86 5.7 TGAATGTTTTTGATTGTTTG
Staphylococcus epidermidis ATCC 12228
SE0470 fruR -88 6.4 TGATTGTTTTTGATTGAAAA
SE0470 fruR -68 5.5 TGGAAGATTTTGATTGAAAT
Staphylococcus carnosus subsp. carnosus TM300
Sca_0346 fruR -84 6.2 TGATTGTTTTTGAATGAAAA
Sca_0346 fruR -64 5.9 TGAAAGATTTTGATTGAAAA
Staphylococcus haemolyticus JCSC1435
SH2196 fruR -65 5.7 TGACAATTTGTGATTGAAAA
SH2196 fruR -75 5.1 TGATTGTTTTTGACAATTTG
SH2196 fruR -85 5.8 TGAATGTTTTTGATTGTTTT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP2019 fruR -84 5.7 TGACTGTTTTTGATTGTTTT
SSP2019 fruR -74 5.6 TGATTGTTTTTGACGAAAAA
Macrococcus caseolyticus JCSC5402
MCCL_0452 fruR -88 5 TCTCTTTTTTTGATTGTAAA
MCCL_0452 fruR -78 5 TGATTGTAAATGAATGAATT
MCCL_0452 fruR -68 4.9 TGAATGAATTTGGTTGACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD