Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzrA in Staphylococcaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: CzrA - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1947 czrA -40 7.3 AATATATGAACAAATATTCATATGAA
Staphylococcus capitis SK14
STACA0001_0851 czrA -39 7.6 AATATATGAACAAATATTCATATAAA
Staphylococcus epidermidis ATCC 12228
SE1746 czrA -21 7.7 AATATATGAACAAATATTCATATGTT
Staphylococcus carnosus subsp. carnosus TM300
Sca_1651 czrA -45 7.5 TATATATGAATAGTTGTTCATATATT
Staphylococcus haemolyticus JCSC1435
SH0889 czrA -41 8 AATATATGAACATATATTCATATATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP0736 czrA -52 7.9 AATATATGAACAAATATTCATATATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD