Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CymR in Staphylococcaceae

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1850 SA1850 -40 5.2 TAATACATACTAAACTTATCGGAAATG
SA0198 SA0198 -77 4.8 TAATCTTGAGTAGATTACTATGATATA
SA0165 SA0165 -59 4.9 GTAATCCGATAAGAATTATAGTAATAT
SA0420 metN2 -42 5.8 TTATTCCTAGTGGATTAATAAGAATTT
SA1936 luxS -244 4.8 GAATTATTACTTATTCTATCGGTTTTA
SA0418 mccA -88 5.8 TAATTCTTATCTGAAAAGTAAGAATTA
SA0471 cysK -55 5.1 TATATCCGATAAATAAACTAAGATTTC
SA2413 cysJ -257 4.7 TAATAAATAGTAAATAAATAAAAAATA
SA0368 tcyP -54 5.8 TTATTCTTAGCATACTAGTCGGAATTA
SA2202 tcyA -40 6.2 TTATTCCGATTAGAATAATAAGAATAA
SA0166 ssuB -41 6 TAATTCCTATTAAAATAGTAGGGATTA
SA2080 SA2080 -62 4.6 TAAAGTCGAGTGTTAAACTAGGAATAA
Staphylococcus capitis SK14
STACA0001_1811 cysJ -246 4.7 TAAAGCATAGTATTCCGATAAGATATA
STACA0001_1812 cysH -71 5.5 TTATTCTGACAATTCAGATAGGAATTT
STACA0001_1208 SA2080 -57 4.2 AAAAGTCGAGTGTTAAACTAGGATTAA
STACA0001_1483 metN2 -43 5.4 ATATTCAGATAAGTATAATCAGAATTG
STACA0001_0838 luxS -193 5.5 TAATTATTACTTATTCTATCGGAATAA
STACA0001_1480 mccA -96 5.4 TAATTCATACCTGATAAGTAAGAATTT
STACA0001_2088 cysK -57 4.9 TATATCCGATAGGAAAACTAAGTTTTA
STACA0001_1450 tcyP -57 5.1 ATATCCTTATTATATATGTCGGAATAC
STACA0001_1063 tcyA -40 6 TTATTCCGATTAGAATAATAAGATTAA
Staphylococcus epidermidis ATCC 12228
SE1993 tcyA -40 6.2 TTATTCCGATTAGAATAATAAGAATAA
SE1858 SA2080 -65 4.4 TAAAGTCGAGTGTTAAACTATGAATAA
SE1646 SA1850 -35 4.6 AATACCTTAGTATTTATATCGGAAAAG
SE2322 metN2 -42 5.3 ATATTCAGATAATTTTAATCGGAAATT
SE1732 luxS -182 5.6 TAATTATTACTTATTTTATCGGATTTA
SE2324 mccA -96 5.7 TAATTCATATCTGATAAGTAAGAATTA
SE2270 cysK -58 4.8 TATATCCGATAGAAAAACTAAGTATTG
SE2180 cysJ -273 4.7 CAAAACATAGTATTCCGATAAGAAATA
SE2181 cysH -68 5 TTATTCTGACAATTCTGATATGTTTTG
SE2354 tcyP -56 5.3 TTATTCTTATTACATATGTCGGAATAC
Staphylococcus carnosus subsp. carnosus TM300
Sca_1637 luxS -110 4.7 TTATCCCGAGTAAACTTATCAACTTAA
Sca_0086 mccA -92 5.6 TAATCCATATCAGTATAGTAGGAATAA
Sca_0164 cysK -143 4.4 GATATCCGATGAAATAGCTAAGATATA
Sca_0062 ytnM -105 5.4 TAAATCCTTGTAAACCAATAAGAATAA
Sca_0059 cysJ -52 5.9 TAATTCCTACTAAAAAACTAAGAATAA
Sca_0059 cysJ -134 5.4 TAATTCTTAGTAAACCTATTGGAATTA
Sca_0042 tcyP -269 5 TAAATACGATATATTTACTAAGGATTT
Sca_1910 tcyA -40 5.4 TTATTCCGATGAGAATGATAAGGATAA
Sca_1777 SA2080 -56 4.4 TTAATCCGAGTGATACACTAAACTTAA
Sca_1551 SA1850 -38 4.8 TAAAACTTACTAACATTATCGGAAAAG
Sca_0042 tcyP -151 4.3 TTTTACCTACATAACTACTATTTAAAA
Staphylococcus haemolyticus JCSC1435
SH2589 tcyP -49 5.4 TTATCCTTATTAAGTATGTCGGAATTA
SH0639 tcyA -41 5.9 TTATTCTGACTAATCTAATAGGAATAT
SH0767 SA2080 -266 4.4 TAATGTCGAGTGATAAACTAGGTTTAA
SH0901 luxS -182 5.6 TAATTATTACTTATTTTATCGGATTTA
SH2549 mccA -109 5.4 TAATTCATAGTGATTGAGTAAGAATTA
SH2497 cysK -56 4.9 TATATCCGATAGAAAAACTAAGTTTTA
SH0419 cysD -48 4.9 TAAAACCGAGTAAACTAATCTAATTAA
SH0414 cysJ -152 4.5 TAAAACATAGTATTCTGATATGTTTTG
SH0413 cysH -68 5.6 TTATTCTGACAATTCTGATAGGTATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP2329 tcyP -63 4.6 ATATCCTTAGTATACGTATCGGATTTC
SSP0242 tcyA -37 5.8 TTATTCCGATAAGAATAATAAGAATAG
SSP0459 ssuB -41 5.7 CAATTCTTATTAAAACGATAAGAATAA
SSP0622 SA2080 -110 5.1 TAAATCTTATCGGTAAAGTAAGGATTT
SSP2408 cysJ -152 4.5 AATAACCTAGTATTCGTATCGGAAATA
SSP0751 luxS -159 5.1 TAATTATTACTTATTCTATCGGGTTTA
SSP0252 mccA -57 5 TAATTCTTATCGGTATAGTAAGGTATT
SSP0252 mccA -144 5.1 GTATGCTTACTGAAAAAGTAGGAATTA
SSP2243 cysK -55 5.1 TATATCCGATTGAAAAAGTAGGTTTTA
SSP2408 cysJ -58 4.6 TTAAACCTATTTAGACAATAATTATAA
SSP0834 SA1850 -37 5.1 TTAATCTTATTGATTTTATCGGGAAAG
SSP0460 SA0165 -69 4.8 CATATCCTTGTAATCTGATAAGATTTA
Macrococcus caseolyticus JCSC5402
MCCL_0267 tcyP 32 5.5 TAATTCTTAgTAtTcTtATAGGAtTac
MCCL_1425 tcyA -38 5.3 CTATTCCGAGTAAATTGATATGAATAG
MCCL_0131 SA2080 -256 4.5 TATTTCCTAGATAATAAATAATGTATT
MCCL_0379 SA1850 -40 5.8 TATTTCTTACTAAATCTATCGGAATTA
MCCL_1789 mccA -46 5.6 TAATCCCGAGTTATCTGATAAGAATAA
MCCL_1900 cysK -50 5.4 TAAATCCGATAAGCGTAATAAGAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD