Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RspR in Oceanospirillales/Alteromonadales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromohalobacter salexigens DSM 3043
Csal_2973 rspR -46 6.2 CCAACTACCATACTAGTCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD