Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RspR in Rhodobacterales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Paracoccus denitrificans PD1222
Pden_5067 rspR -48 5.8 TTTACTAGTATGCAAGTATG
Silicibacter pomeroyi DSS-3
SPO1723 uxuA -71 5.4 CATACTTCCATACTAGTCGG
SPO1722 rspR -47 5.4 CCGACTAGTATGGAAGTATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD