Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RspR in Enterobacteriales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Regulog: RspR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_03735 uxaC2 -133 5.6 TACACTTGTATGGTAGTAGA
CKO_01575 rspA -70 5.8 TATACTTGTATGGTAGTAGT
Enterobacter sp. 638
Ent638_1932 rspA -70 5.6 AATACTTGTATGGTAGTAGC
Erwinia carotovora subsp. atroseptica SCRI1043
ECA0917 rspA -37 5.3 TATACTTGTATGGTAGTCAG
Escherichia coli str. K-12 substr. MG1655
b1581 rspA -70 5.8 TATACTTGTATGGTAGTAGC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_01587 rspD -132 5.2 TCTTCTTGTATGGTAGTTGA
KPN_03621 rspB -49 5.3 CATACTTGTATGGTAATAAA
Salmonella typhimurium LT2
STM1505 rspA -69 5.8 TATACTTGTATGGTAGTAGC
Serratia proteamaculans 568
Spro_3563 rspA -74 5.3 CATACTTGTATGGTAGTTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD