Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Clostridia-2

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium bartlettii DSM 16795
CLOBAR_00632 xylB -211 121.3 TATATGTCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTAAAGCCCGCGAGCTATGAAAATAGTTGATTTGGTGAAAATCCAAAGCCGACAGTATAGTCTGGATGAGAGAAGAATGTT
CLOBAR_00719 ribU -231 119.4 AAAAAATCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTAAAGCCCGCGAACTATGAAAATAGCTGATTTGGTGAAATTCCAAAGCCGACAGTAGAGTCTGGATGAGAGAAGAGAGTT
CLOBAR_00909 ribD -253 120.7 GATTATTCTTCGGGGCAGGGTGTAATTCCCGACCGGCGGTATAGCCCGCGAGCTACATTGTAGCTGATTTGGTGAGATTCCAAAGCCGACAGTAAAGTCTGGATGAAAGAAGATAAAA
Clostridium difficile 630
CD3299 ribZ -289 97.5 TTTTTCTTCATAAACGGGTGAAATTCCCTATCGGCGGTAAAAGCCCGCGAGCCTTATGGCATAATTTGGTCATATTCCAAAGCCAACAGTAAAATCTGGATGGTAGAAGAAAATAGT
CD0147 ribU -268 123.2 AAGATCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTATAGCCCGCGAACTACTTAGGTGGTTGATTTGGTGAGATTCCAAAGCCGACAGTAAAGTCTGGATGAGAGAAGATATTTAT
CD1700 ribD -254 118.8 ACTTAATCTTCGGGGTAGGGTGAAATTCCCAATCGGCGGTATAGCCCGCGAGCCAAGGTAAAACTTGGTTGATTTGGTTAAATTCCAAAGCCGACAGTAAAGTCTGGATGGAAGAAGATATTT
Clostridium hiranonis DSM 13275
CLOHIR_00483 ribD -211 123 ACTATCTTCAGGGCAGGGTGAAATTCCCTACCGGTGGTAAAGCCCACGAGCTGCAAAGCATGATTCGGTGTAATTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGATGAAAAG
CLOHIR_01113 ribU -311 112.6 GATGTCTTCAGGGCAGGGTGAGATTCCCGACCGGCGGTATAGTCCGCGAGCGTTTTTTAAAACGCAGGAATTGGCATAAGTTCAATTCAGGATTTGGTGAAATTCCAAAACCGACAGTATAGTCTGGATGAGAGAAGATGTGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD