Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CggR in Staphylococcaceae

Properties
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-diphosphate
Regulog: CggR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0726 cggR -85 6.9 TTTTGTCCCACGCGGGACTTAA
Staphylococcus capitis SK14
STACA0001_0256 cggR -91 6.7 TTTTGTCCCAGGTGGGACTTAA
Staphylococcus epidermidis ATCC 12228
SE0556 cggR -91 6.7 TTTTGTCCCAGGTGGGACTTAA
Staphylococcus carnosus subsp. carnosus TM300
Sca_0423 cggR -77 6.7 TTTTGTCCCACCCGGGACTTAA
Staphylococcus haemolyticus JCSC1435
SH2114 cggR -81 6.7 TTTTGTCCCGCGCGGGACACAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1917 cggR -78 5.9 TTTTGTCCTGCTAGGGACGTAA
Macrococcus caseolyticus JCSC5402
MCCL_0520 cggR -47 5.9 TTTTGACCCGAGTGGGACGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD