Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BirA in Staphylococcaceae

Properties
Regulator family: BirA
Regulation mode: repressor
Biological process: Biotin biosynthesis
Effector: Biotin
Regulog: BirA - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0533 yhfT -48 7.1 AATGTTAACAAGATGTATTTTAAAGTTTACATT
SA2077 bioY -75 7.5 ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT
SA2215 bioD -55 7.9 AATGTAAACTTATTAATTATAAAAGTTTACATT
Staphylococcus capitis SK14
STACA0001_0458 yhfT -43 7.2 AATGTTAACATATTTATAAATATAGTTTACATA
STACA0001_1211 bioY -70 7.8 TATGTAAACTTTTTATTTCTTAAAGTTTACATT
STACA0001_0034 bioB -87 8 AATGTAAACTTATAAATATATAAAGTTTACATT
Staphylococcus epidermidis ATCC 12228
SE0344 yhfT -44 7.1 AATGTAAACATAATTATATAAAGTGTTTACAAA
SE1856 bioY -70 6.9 ATTGTAAACTTTCCATTCATAAAAGTTTACAAG
SE0234 bioB -110 7.9 AATGTAAACTTATAAATATATAAAGTTTACAAT
SE0179 bioD -55 7.7 AATGTAAACTTTAAAATGTAATAAGTTTACATT
Staphylococcus carnosus subsp. carnosus TM300
Sca_2225 bioY -73 8 AATGTAAACTTATAAAAATTAAAAGTTTACATT
Sca_0740 pycA -367 7.2 AATGTAAACTTAAAAATAAATAAAATTAACAAT
Sca_1775 bioY -75 7.3 AATGTAAACTTTTAGTAAATTCAAGTTAACAAT
Sca_2002 bioB -63 7.4 AATGTTAACTATATAAAAAAATAAGTTAACAAT
Staphylococcus haemolyticus JCSC1435
SH2418 yhfT -55 7.6 AATGTTAACATAATATAAAATAAAGTTAACATT
SH0770 bioY -69 8.2 AATGTAAACTTTTTATTTTATAAAGTTTACATT
SH0269 bioB -75 8 AATGTAAACTTATTTATATATAAAGTTTACATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP2146 yhfT -49 6.6 AATGTTAACATATTTGTTATGAAGGTTAACAAA
SSP0625 bioY -67 8.1 AATGTAAACTTTTTATTTTTTAAAGTTTACATT
Macrococcus caseolyticus JCSC5402
MCCL_0376 bioB -76 6.8 ATTGTTAACTTATATTCAAAATTAGTTTACAAT
MCCL_0134 bioY -75 6.7 ATTGTTAACTTTTTGTACTAAAAGGTTAACGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD