Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArsR in Staphylococcaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Regulog: ArsR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1591 arsR -56 6.2 AATATAGACATTCATCTATATA
SAP016 arsR -41 6.7 TATATAGATGTTAATCTATTTA
SAP016 arsR -57 6.1 AACATAGACAATAATCTATATA
SA1591 arsR -40 6.9 TATATAGATGATAATCTATTTA
Staphylococcus capitis SK14
STACA0001_1318 arsR -42 6.8 TATATAGATGATAATCTATAAT
STACA0001_1318 arsR -58 6 TATATAGATATTTGTCTATATA
Staphylococcus epidermidis ATCC 12228
SE0138 arsD -49 6.4 TATATAGATGTTAGTCTATAAT
SE0138 arsD -65 5.9 AACATAGACATTAATCTATATA
SE0139 arsR3 -332 4.8 AATATATATATTGATTTATATT
SE0139 arsR3 -477 5.9 TATATAGATTAATGTCTATGTT
SE0139 arsR3 -493 6.4 ATTATAGACTAACATCTATATA
Staphylococcus haemolyticus JCSC1435
SH0112 arsD -213 5.3 AATATAAATCAATATCTATATT
SH0113 SH0113 -90 5.3 AATATAGATATTGATTTATATT
SH0113 SH0113 -238 5.1 TATATAGATTGGTGTCTATGTT
SH0113 SH0113 -254 6.7 ATTATAGATTAACATCTATATA
SH0103 arsR -42 6.8 TATATAGATGATAATCTATAAT
SH0112 arsD -65 5.1 AACATAGACACCAATCTATATA
SH0112 arsD -49 6.7 TATATAGATGTTAATCTATAAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP2384 arsR -40 6.5 TATATAGATGTTAGTCTATGTA
SSP2384 arsR -56 5.4 AATATAGACACCAATCTATATA
SSPP119 arsD -49 6.1 TATATAGATGTTAATCTATGGT
SSPP119 arsD -65 5.8 TACATAGACACTAATCTATATA
SSPP120 SH0113 -241 5.8 TATATAGATTAGTGTCTATGTA
SSPP120 SH0113 -257 6.1 ACCATAGATTAACATCTATATA
Macrococcus caseolyticus JCSC5402
MCCL_1484 arsR -46 6.8 TATATAGATGTTAATCTATGTA
MCCL_1484 arsR -62 5.6 TATATAGACACTTATCTATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD