Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PaaR in Mycobacteriaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium abscessus ATCC 19977
MAB_0902 paaJ -48 4.7 GACAACCGACCGAACGATCGGT
MAB_0902 paaJ -44 6.2 ACCGACCGAACGATCGGTTATT
MAB_0901c paaR -92 6.2 AATAACCGATCGTTCGGTCGGT
MAB_0901c paaR -88 4.7 ACCGATCGTTCGGTCGGTTGTC
MAB_0906 paaA -37 6.1 AATAACCGAACATTCGGTCGGT
MAB_0906 paaA -33 4.5 ACCGAACATTCGGTCGGTAATC
MAB_0900c paaZ -108 4.9 ACTGACCGTTCGGTCGGCCACA
MAB_0900c paaZ -35 5.4 ACCGAACGAATGGACGGTTGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD