Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Enterococcaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Enterococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Enterococcus faecalis V583
EF2074 mntA -88 6.1 GTATTTAGGTGCGCCTAAAAAT
EF2074 mntA -33 5.8 ATTTTAAGGCAAACCTAAAAAA
EF0575 mntA -78 6 AAATTTAGGCTTGACTAAAATA
EF1057 mntH -90 6.6 TATTTTAGGTGTACCTAAAATA
EF1901 mntH -57 6 ATTTTTAGGTGTGCCTAAAAGT
Enterococcus faecium DO
EfaeDRAFT_2039 mntA -33 5.9 AAAGTTAGGTAAACCTAAAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD