Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzrA in Clostridia-1

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog: CzrA - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium acetobutylicum ATCC 824
CAC2242 czrA -45 7.4 CATATGAACATATATTCATATG
Clostridium beijerincki NCIMB 8052
Cbei_1448 czrA -44 6.9 CGTATGAACAGATATTCATATG
Clostridium botulinum A str. ATCC 3502
CBO0477 czrA -68 6.7 CATATGAACAATTATTCATACG
Clostridium butyricum 5521
CBY_3037 czrA -41 7.1 CATATGAACAGATGCTCATATG
Clostridium kluyveri DSM 555
CKL_2303 cadA -159 6.3 CATATGAACAATAACTCATATG
Clostridium novyi NT
NT01CX_1198 czrA -35 7.1 CATATGAATATATGTTCAAATG
Clostridium perfringens ATCC 13124
CPF_2588 czrA -49 7.1 CATATGAACAGATGCTCATATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD