Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzrA in Listeriaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog: CzrA - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin2636 czrA -42 6.5 CATATGAATATATGACCATATA
Listeria monocytogenes EGD-e
lmo2493 czrA -43 6.8 CATATGAGTATATGAACATATA
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_2393 czrA -43 6.5 CATATGAGTATATGAACATGTA
Listeria welshimeri serovar 6b str. SLCC5334
lwe2441 czrA -43 6.8 CATATGAGTATATGAACATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD