Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EutR in Mycobacteriaceae

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Regulog: EutR - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium sp. JLS
Mjls_0224 COG0121 -80 4.9 TATGTCATGAATGTTTCAAG
Mjls_0224 COG0121 -69 4.7 TGTTTCAAGTTCTTTAAAAT
Mjls_0223 eutB -66 4.7 ATTTTAAAGAACTTGAAACA
Mjls_0223 eutB -55 4.9 CTTGAAACATTCATGACATA
Mycobacterium vanbaalenii PYR-1
Mvan_2921 COG0121 -86 4.8 TATGTCATAAATGTTTCAGC
Mvan_2920 eutB -62 4.8 GCTGAAACATTTATGACATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD