Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EutR in Burkholderia

Properties
Regulator family: RpiR
Regulation mode:
Biological process:
Effector:
Regulog: EutR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia cepacia AMMD
Bamb_4138 eutR -167 5 AATGTTTGTTTTATTACACA
Bamb_4137 PF01019 -188 5 TGTGTAATAAAACAAACATT
Bamb_4137 PF01019 -70 5.5 AATGTACTGTTCATTACATG
Burkholderia sp. 383
Bcep18194_B0996 PF01019 -216 4.9 TCTGTAATAAAACAAACATA
Bcep18194_B0996 PF01019 -100 5.7 AATGTATTGTTTATTACATG
Bcep18194_B0995 eutR -167 4.9 TATGTTTGTTTTATTACAGA
Burkholderia vietnamiensis G4
Bcep1808_5278 eutR -166 4.8 AATGTTTGATTCGTTACACG
Bcep1808_5277 PF01019 -213 4.8 CGTGTAACGAATCAAACATT
Bcep1808_5277 PF01019 -99 5.6 AATGTATCGTTCATTACATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD