Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EutR in Pseudomonadaceae

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Regulog: EutR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA5506 eutR -83 5 AATGTAGTGAAAAAAACATT
Pseudomonas fluorescens Pf-5
PFL_2247 eutR -77 5.5 CATGTAGCGTCTATTACATA
PFL_2247 eutR -38 4.4 TATGAAATAAAAACGACATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD