Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EutR in Oceanospirillales/Alteromonadales

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Regulog: EutR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromohalobacter salexigens DSM 3043
Csal_0675 eutA -64 4.8 TTTGAAAAAATATTGACACG
Csal_0674 eutR -84 4.8 CGTGTCAATATTTTTTCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD