Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EutR in Rhizobiales

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Regulog: EutR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Agrobacterium tumefaciens str. C58 (Cereon)
Atu2144 eutA -56 5.1 TGTGAAGAATTCTTTTCGTC
Atu2144 eutA -98 5.1 AATGAAGAGAAAATTTCAAA
Atu2145 eutR -94 5.1 TTTGAAATTTTCTCTTCATT
Atu2145 eutR -136 5.1 GACGAAAAGAATTCTTCACA
Mesorhizobium sp. BNC1
Meso_1871 eutA -89 5.4 GGTGAAGAGAATTTTTCAAA
Meso_1872 eutR -123 4.5 TTTGAAATTAATCATTCAGA
Meso_1871 eutA -47 4.5 TCTGAATGATTAATTTCAAA
Meso_1872 eutR -81 5.4 TTTGAAAAATTCTCTTCACC
Rhizobium etli CFN 42
RHE_CH02888 eutA -169 5.9 CATGAAAAGAAATTTTCAGA
RHE_CH02888 eutA -127 5.3 CCTGAAGAATTCTTTTCTTA
RHE_CH02889 eutR -32 5.9 TCTGAAAATTTCTTTTCATG
RHE_CH02889 eutR -74 5.3 TAAGAAAAGAATTCTTCAGG
Rhizobium leguminosarum bv. viciae 3841
RL3348 eutA -57 5 CCTGAAGAATTCTTTTCTTC
RL3348 eutA -99 5.7 CATGAAAAGAAATTTTCAGT
RL3349 eutR -144 5 GAAGAAAAGAATTCTTCAGG
RL3349 eutR -102 5.7 ACTGAAAATTTCTTTTCATG
Rhizobium sp. NGR234
NGR_c21470 eutA -93 5.7 ACTGAAAAGATCGTTTCAGA
NGR_c21470 eutA -51 5.7 CGTGAAGAATTCTTTTCACG
NGR_c21480 eutR -136 5.7 CGTGAAAAGAATTCTTCACG
NGR_c21480 eutR -94 5.7 TCTGAAACGATCTTTTCAGT
Sinorhizobium meliloti 1021
SMc01600 eutA -95 5.6 TTTGAAAAGATCGTTTCAGT
SMc01600 eutA -53 5.6 CGTGAAGAATTCTCTTCACA
SMc01602 eutR -137 5.6 TGTGAAGAGAATTCTTCACG
SMc01602 eutR -95 5.6 ACTGAAACGATCTTTTCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD