Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EutR in Rhodobacterales

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Regulog: EutR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Loktanella vestfoldensis SKA53
SKA53_10334 eutR -46 5 TTTGAAACAAACGTTTCAAC
SKA53_10329 eutA -101 5 GTTGAAACGTTTGTTTCAAA
Oceanicola batsensis HTCC2597
OB2597_09014 eutR -53 5.3 CCTGTAACAATTTCTACAAA
OB2597_09009 eutA -53 5.3 TTTGTAGAAATTGTTACAGG
Paracoccus denitrificans PD1222
Pden_4543 eutA -93 4.1 TTCGTAACATTCTTAACAGG
Pden_4543 eutA -63 5.1 TCTGAAAAATAATTGACAGA
Pden_4542 eutR -48 4.1 CCTGTTAAGAATGTTACGAA
Pden_4542 eutR -78 5.1 TCTGTCAATTATTTTTCAGA
Rhodobacter sphaeroides 2.4.1
RSP_2323 eutA -87 4.3 GAAGAAAAATTCTTGACAGA
RSP_2324 eutR -107 4.3 TCTGTCAAGAATTTTTCTTC
RSP_2324 eutR -78 4.6 GCTGTTAAGATGTTTACTGC
RSP_2323 eutA -116 4.6 GCAGTAAACATCTTAACAGC
Roseobacter sp. MED193
MED193_10026 eutA -64 5.1 TCTGAAATTATATTGACAGA
MED193_10026 eutA -34 5.1 CGTGAAAAGATTTTTCCAAA
MED193_10021 eutR -143 5.1 TTTGGAAAAATCTTTTCACG
MED193_10021 eutR -113 5.1 TCTGTCAATATAATTTCAGA
Roseovarius nubinhibens ISM
ISM_11450 eutR -109 5.8 TTTGAAAAAATGTTTTCACA
ISM_11445 eutA -62 5.8 TGTGAAAACATTTTTTCAAA
Roseovarius sp. 217
ROS217_08279 eutR 11 4.8 TGTGTCAATATATTTCCAGC
ROS217_08279 eutR -19 5.6 TTTGTAAAAATGTTTCCACA
ROS217_08284 eutA -36 5.6 TGTGGAAACATTTTTACAAA
ROS217_08284 eutA -66 4.8 GCTGGAAATATATTGACACA
Silicibacter TM1040
TM1040_2788 eutR -70 5.2 TCTGTAAAAATTCTTTCATC
TM1040_2787 eutA -54 5.2 GATGAAAGAATTTTTACAGA
Silicibacter pomeroyi DSS-3
SPO2602 eutR -105 5.1 TGTGTAACATTGGTTACAAC
SPO2602 eutR -61 5.3 TCTGTAGACATGATTACAGA
SPO2603 eutA -10 5.1 GTTGTAACCAATGTTACACA
SPO2603 eutA -54 5.3 TCTGTAATCATGTCTACAGA
Sulfitobacter sp. EE-36
EE36_04403 eutA -83 4.8 TGTGAAGCAAAGATTACAGA
EE36_04408 eutR -51 4.8 TCTGTAATCTTTGCTTCACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD