Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SdaR in Xanthomonadales

Properties
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xanthomonas axonopodis pv. citri str. 306
XAC4361 grtP -102 6.1 ATTTGGGCAGTTGCACAAAA
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC4227 grtP -88 5.1 GCTTGGGTGTTTGCACAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD