Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FnrN in Rhodospirillales

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acetobacter pasteurianus IFO 3283-01
APA01_25650 fnrN -207 6 GCCTTGATTTAGATCAAATC
APA01_25640 ompW -90 6 GATTTGATCTAAATCAAGGC
Azospirillum sp. B510
AZL_003350 ccoN -192 5.1 TCGTTGACGTAGATCAATGT
AZL_003210 hemA -138 5.5 GGCTTGATTTCGATCAATGC
Gluconacetobacter diazotrophicus PAl 5
Gdia_1984 fnrN -126 6 GCATTGATTCAGATCAATTC
Gdia_1985 ompW -94 4.8 CGGTTGATTCATGTCAAGGC
Gluconobacter oxydans 621H
GOX0973 ompW -75 5.4 GACTTGATTCAGGTCAACGT
GOX0974 fnrN -90 5.4 ACGTTGACCTGAATCAAGTC
Magnetospirillum magneticum AMB-1
amb0883 cycA -78 5.9 GACTTGACCTTGCTCAATGC
Magnetospirillum magnetotacticum MS-1
Magn03010752 cycA -77 5.9 GACTTGACCTTGCTCAATGC
Magn03010411 ccoN -161 5 ACTTTGATATATGTCAATGG
Rhodospirillum centenum SW
RC1_1280 ccoN -190 4.9 GCATTGACATTCGTCAAAAC
RC1_1607 ompW -121 5.5 GAATTGATCCAGGTCAGGGC
RC1_0996 hemA -164 5.4 GAATTGACCGACATCAACGC
RC1_1280 ccoN -120 5.4 CCGTTGATTCAAATCAATGC
RC1_2984 fnrN -305 5.2 ACCTTGACTTGGATCAAGAC
Rhodospirillum rubrum ATCC 11170
Rru_A3332 ccoN -324 5.7 GATTTGATCTAAATCAATGG
Rru_A3322 fnrN -119 4.6 GGTTTGACCTGGATCAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD