Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FixK in Caulobacterales

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FixK - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC0762 cydA -93 6.2 GCCTTGATCCGGATCAAGGA
CC3407 ctaC -45 5.6 GCCTTGATCGGGCTCAAATC
CC3407 ctaC -12 4.9 GCCGTGAGGGATATGAAGGC
CC1401 ccoN -73 5.8 GCTTTGATGCGTGTCAAAGC
CC0761 cydD -50 6.2 TCCTTGATCCGGATCAAGGC
CC0759 fixL -37 5 GCCTTGACCTGGCTCAAACG
CC0752 fixK -143 5.2 GCCTTGATCGGCGTCAAAAT
Caulobacter segnis ATCC 21756
Cseg_1891 hemN -65 4.7 GGATTGATCCAAATCACGGC
Cseg_1883 ccoN -75 5.7 GCTTTGAGACAGATCAAAGC
Cseg_0283 ctaC -45 4.2 ACATTGATCATCGTCAAATC
Cseg_0283 ctaC -12 4.9 GCCGTGAGGGATATGAAGGC
Cseg_3612 fixK -139 5.2 ACTTTGATCCCGGTCAAAAC
Cseg_3606 cydD -50 5.8 GCCTTGATCGTGATCAAGGA
Cseg_3609 fixL -64 4.9 GCCTTGACCTGCCTCAAACG
Cseg_3605 cydA -92 5.8 TCCTTGATCACGATCAAGGC
Caulobacter sp. K31
Caul_3872 hemN -64 5.2 GACTTGACGCGCGTCAAGGT
Caul_2437 ccoN -69 4.5 GCTTTGACCCAAGTCAATTT
Caul_4506 ctaC -75 4.3 ACGTTGATGTACGTCAAATC
Caul_4506 ctaC -42 4.9 GCCGTGAGGGATATGAAGGC
Caul_0633 cydD -77 4.1 CCCTATAGACGCGTCAAGGC
Caul_0633 cydD -51 5.5 GCTTTGATTGGTGTCAAGGA
Caul_0634 cydA -92 5.5 TCCTTGACACCAATCAAAGC
Phenylobacterium zucineum HLK1
PHZ_c2806 hemN -52 5.3 TCCTTGATCTGAATCAGGGC
PHZ_c2798 fixK -136 5 GATGTGACGGCGATCAAAGC
PHZ_c2814 ccoN -40 6 GCCTTGACCGATATCAAGGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD