Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FnrN in Rhodobacterales

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_3858 fnrN -56 5.4 GCATTGATTTGGATCAAGCG
Jann_1933 hemA -67 5.9 CCTTTGATCCAGATCAAAGC
Jann_3859 hemN -51 5.4 CGCTTGATCCAAATCAATGC
Jann_3857 ccoN -126 5.6 GGCTTGACCCAGATCAAGGT
Jann_3853 ccoG -84 5.4 AACTTGATCCACGTCAAAGC
Loktanella vestfoldensis SKA53
SKA53_02751 hemA -167 4.9 TTATTGATCCAGATCATGGT
SKA53_08751 uspA -136 5.1 TCGTTGATGTGGATCAACCC
SKA53_08751 uspA -114 5.3 CGTTTGACATGGATCAATGC
SKA53_08741 ccoN -105 5.3 GCATTGATCCATGTCAAACG
SKA53_08741 ccoN -83 5.1 GGGTTGATCCACATCAACGA
SKA53_08641 ccoG -177 5.6 TGCTTGATCCACATCAAGGA
Oceanicola batsensis HTCC2597
OB2597_01932 hemA -155 5.3 GAATTGATTCACATCAAGGA
OB2597_06915 ctaD -113 5.2 TATTTGATCTGCGTCAATAC
OB2597_15845 ctaC -189 5.6 TTCTTGATCCAGATCAAAAA
OB2597_20571 ccoN -73 4.9 CAATTGACCCAAGTCAAAAC
OB2597_20591 ccoG -77 5.7 GCCTTGATGCAGATCAAAGG
Oceanicola granulosus HTCC2516
OG2516_17525 uspA -74 5.9 GCCTTGATCTGGATCAAGGT
Paracoccus denitrificans PD1222
Pden_1850 fnrN -131 5.3 ACCTTGACCCAAATCAAATG
Pden_1851 hemN -51 5.3 CATTTGATTTGGGTCAAGGT
Pden_1822 hemA -40 5.4 GGCTTGATGCGTATCAAGGT
Pden_1849 uspA -146 5.3 ACTTTGATCTGCGTCAATCT
Pden_3636 ompW -51 5.5 ATCTTGATCCAGATCAACGT
Pden_0893 ccpR -141 5.1 CATCTGACCCAGATCAAAGC
Pden_1848 ccoN -124 5.3 AGATTGACGCAGATCAAAGT
Pden_1844 ccoG -70 5.3 CGCTTGACGCAGATCAATGC
Rhodobacter sphaeroides 2.4.1
RSP_1877 ctaD -127 5.6 TTATTGATCCAGATCAAAGT
RSP_0698 fnrN -31 5.5 GCTTTGATTCAGATCAAGCG
RSP_1826 ctaC -161 5.5 TCCTTGATTCAGATCAAATG
RSP_0699 hemN -51 5.5 CGCTTGATCTGAATCAAAGC
RSP_2984 hemA -87 5.2 GATTTGATCCTTATCAAGGC
RSP_0696 ccoN -136 5.1 TCCTTGATGAGGATCAAGTA
RSP_0697 uspA -111 5.4 GCCTTGATCCATGTCAATGG
RSP_0697 uspA -79 5.1 TACTTGATCCTCATCAAGGA
RSP_0696 ccoN -104 5.4 CCATTGACATGGATCAAGGC
RSP_2507 ompW -69 5.4 CCATTGACGCAGATCAAGGC
RSP_2395 ccpR -81 5.2 GAATTGATCTAAGTCAAAGG
Rhodobacterales bacterium HTCC2654
RB2654_06514 ctaC -192 5.3 GCATTGATCTGCATCAATCG
RB2654_10044 fnrN -29 5.3 ACATTGATACGGATCAAATG
RB2654_08222 ctaD -212 5.6 TCCTTGACCCGGATCAAACA
RB2654_10034 uspA -143 5.4 ACCTTGATCCATGTCAAAAC
RB2654_10034 uspA -100 5.3 GATTTGACACATATCAAAGC
RB2654_03389 hemA -127 5.3 GGTTTGATCCACGTCAACGC
RB2654_10049 hemN -52 5.3 CATTTGATCCGTATCAATGT
RB2654_10029 ccoN -168 5.3 GCTTTGATATGTGTCAAATC
RB2654_10029 ccoN -125 5.4 GTTTTGACATGGATCAAGGT
RB2654_10004 ccoG 0 5.2 ATGTTGATCCAAGTCAAGGC
Roseobacter sp. MED193
MED193_08963 ctaC -178 5.4 TTTTTGATCTAAATCAAGAA
MED193_11238 fnrN -29 5.3 ACTTTGACTTGGATCAAACG
MED193_21064 hemA -162 5.4 TATTTGACCTGTATCAAAGT
MED193_08728 ctaD -122 5.6 ATCTTGATCCAGATCAAACT
MED193_11233 uspA -114 5.5 GCATTGATCTGCATCAAGAC
MED193_11228 ccoN -93 5.5 GTCTTGATGCAGATCAATGC
MED193_11193 ccoG -180 5.4 TTTTTGATCCACGTCAAAGA
Roseovarius sp. 217
ROS217_04445 ctaC -219 5.2 AATTTGATTTAAATCAAAAA
ROS217_21737 hemA -168 5.2 GACTTGACCCAAGTCAAGGA
ROS217_12216 fnrN -53 5.3 GCTTTGATTTAGATCAACCG
ROS217_15111 ctaD -128 5.4 TCTTTGATCTGCATCAATTT
ROS217_12221 uspA -111 5.4 TCCTTGATCTGTGTCAAAAC
ROS217_12221 uspA -79 5.4 CGTTTGATCCGCGTCAAGGC
ROS217_12211 hemN -51 5.3 CGGTTGATCTAAATCAAAGC
ROS217_20807 ompW -75 5.2 AACTTGACCCAAATCAATGT
ROS217_12226 ccoN -143 5.4 GCCTTGACGCGGATCAAACG
ROS217_12226 ccoN -111 5.4 GTTTTGACACAGATCAAGGA
ROS217_12261 ccoG -73 5.5 AATTTGATGCAGGTCAAAGC
Silicibacter TM1040
TM1040_2336 ctaC -164 5.2 TTTTTGATCTAAGTCAAGAA
TM1040_0860 hemA -169 5.4 TATTTGACCTGTATCAAGGA
TM1040_2547 fnrN -29 5.2 GCTTTGACACAGATCAACCA
TM1040_2291 ctaD -125 5.6 TTCTTGATCCAGATCAAACT
TM1040_2546 uspA -126 5.4 ACATTGATCTGTATCAAGAT
TM1040_2548 hemN -51 5.2 TGGTTGATCTGTGTCAAAGC
TM1040_0734 ompW -78 5.2 CATTTGATCTAGATCAGAGC
TM1040_2545 ccoN -117 5.4 ATCTTGATACAGATCAATGT
TM1040_2540 ccoG -79 5.4 TTTTTGATCCACGTCAAAGT
Silicibacter pomeroyi DSS-3
SPO3076 ctaC -162 5.6 TGTTTGATCCAGATCAAAAA
SPO2596 hemA -146 5.1 TAATTGACCCAAGTCAAGGC
SPO3531 fnrN -32 5.4 ACCTTGACTCAGATCAAGTA
SPO1383 ctaD -120 5.6 ATCTTGATCCAGATCAAACT
SPO3527 uspA -98 5.7 GCTTTGATCTGCATCAAGAC
SPO3532 hemN -52 5.4 TACTTGATCTGAGTCAAGGT
SPO2792 ompW -75 5.2 ATCTTGATCCAGATCAGGGA
SPO0330 ccpR -96 5.5 CGCTTGATCCATATCAAAGT
SPO3526 ccoN -110 5.7 GTCTTGATGCAGATCAAAGC
SPO3522 ccoG -80 5.4 TTTTTGACCCATATCAAAGT
Sulfitobacter sp. EE-36
EE36_02238 ccoN -72 5.7 CATTTGATCTAGATCAAGGC
EE36_02218 ccoG -74 5.6 TGTTTGATGCAGATCAAAGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD