Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FnrN in Sphingomonadales

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erythrobacter sp. NAP1
NAP1_15803 ccoN -72 4.6 AACTTGATCTGAGTCAAACA
NAP1_15793 ompW -238 5.7 GCATTGACCTGGATCAATGC
NAP1_15848 hemN -52 5.3 GATTTGATCTGGCGCAAAGA
NAP1_15798 fnrN -3 5.7 GCATTGATCCAGGTCAATGC
NAP1_01820 uspA -70 5.5 AAATTGATCTGGATCAATGC
Novosphingobium aromaticivorans DSM 12444
Saro_2578 ccoN -144 4.6 ACATTGACGGAGCGCAAAAA
Saro_2578 ccoN -77 4.9 TATTTGACAAGGGTCAATGT
Saro_2579 ompW -179 4.9 ACATTGACCCTTGTCAAATA
Saro_2579 ompW -112 4.6 TTTTTGCGCTCCGTCAATGT
Saro_2581 fnrN -232 4.6 GTTTTGACATCCGTCAACGC
Saro_2569 hemN -68 4.9 AATTTGCCATATCTCAATGC
Saro_0571 uspA -71 4.3 AATTTGACGTGGATCATGGT
Sphingobium japonicum UT26S
SJA_C2-00670 ccoN -74 5.5 GCTTTGACAGAGGTCAATGC
SJA_C2-00650 ompW -103 5.4 ACATTGAGCCAGGTCAAATT
SJA_C2-00650 ompW -81 4.5 CGGTTGCGCGGGATCAATGC
SJA_C2-00660 fnrN 10 4.6 GATTTGATCTGGCGCAAAAG
Sphingomonas wittichii RW1
Swit_1801 ccoN -200 5.1 GATTTGATCTGGCGCAAGGC
Sphingopyxis alaskensis RB2256
Sala_1676 ccoN -112 4.6 GCATTGATGGAGCGCAAGCA
Sala_1676 ccoN -90 5.3 TCGTTGATCCCGGTCAATGT
Sala_1677 ompW -97 5.3 ACATTGACCGGGATCAACGA
Sala_1677 ompW -75 4.6 TGCTTGCGCTCCATCAATGC
Sala_1679 uspA -69 4.8 GATTTGATGCGAATCAATGA
Sala_1668 hemN -51 4.8 CCGTTGATGCCGATCAATGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD