Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AgaR2 in Enterococcaceae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylgalactosamine utilization
Effector: N-acetylgalactosamine-6-phosphate
Regulog: AgaR2 - Enterococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Enterococcus faecalis V583
EF1809 agaR2 -37 5.5 TTTGTGGTTATAACCAGTTA
Enterococcus faecium DO
EfaeDRAFT_2711 agaR2 -32 5 ATTGTGGTTATAGCCAGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD