Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AgaR in Clostridia-1

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylgalactosamine utilization
Effector:
Regulog: AgaR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_4564 agaA -58 5.1 AAACTGATAATGTCCACTTA
Cbei_4564 agaA -156 5.9 CAAGTGGTAATTACCACTAA
Cbei_4563 agaR -171 5.9 TTAGTGGTAATTACCACTTG
Cbei_4563 agaR -269 5.1 TAAGTGGACATTATCAGTTT
Cbei_4539 Cbei_4539 -192 4.8 AAACTGGTAGTATCCAGTTA
Clostridium butyricum 5521
CBY_3473 CBY_3473 -19 4.7 AAATTGGTTAATACCAAAAA
CBY_3472 agaA -285 4.7 TTTTTGGTATTAACCAATTT
CBY_3028 agaR -201 5.8 TATTTGGTAATTACCACTTA
CBY_3029 agaA2 -51 6 TAAGTGGTAATTACCAGTTG
CBY_3029 agaA2 -267 5.8 TAAGTGGTAATTACCAAATA
Clostridium novyi NT
NT01CX_0292 agaS -53 5.1 TAACTGGTAATGACAACACA
NT01CX_0293 agaR -41 4.8 TAAGTGGTATGTACAACATG
NT01CX_0299 NT01CX_0299 -235 5.3 GAACTGGTAATGACAACATT
NT01CX_0299 NT01CX_0299 -317 5.8 AATGTGGTAATAACAACATT
NT01CX_0302 agaR -350 4.1 CAACTTGTTCGTACAAGTTG
NT01CX_0301 Cbei_1383 -76 4.1 CAACTTGTACGAACAAGTTG
Clostridium perfringens ATCC 13124
CPF_2961 agaS -38 5.5 CAACTGGTAATGACAACATT
CPF_2961 agaS -83 5 TAACTTGTAATAACATCATT
CPF_2149 agaK2 -40 5.8 CAAGTGGTAATTACAACTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD