Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AgaR in Clostridia-2

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylgalactosamine utilization
Effector:
Regulog: AgaR - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium difficile 630
CD3451 agaZ -106 5.9 AAATTGGTAATAACCACTTT
CD3451 agaZ -251 5.9 TAAGTGGTTATTACCACAAT
CD3452 agaR -182 5.9 AAAGTGGTTATTACCAATTT
CD3452 agaR -37 5.9 ATTGTGGTAATAACCACTTA
CD3449 agaS -246 6.1 TTAGTGGTAATTACCACTTT
CD3449 agaS -53 5.1 AAAGTGGGTATAACCTCATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD