Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FnrN/FixK/AadR in Rhizobiales

Properties
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Regulog: FnrN/FixK/AadR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Agrobacterium tumefaciens str. C58 (Cereon)
Atu2394 sinR -174 5.2 TGTTTGATCGAAATCAATTC
Atu4382 nirK -96 4.3 AGTTTGTTCCATCTCAAATT
Atu4380 nnrR -129 4.3 TAGTTGATTCATATCATTTG
Atu8040 Atu8040 -68 4.3 TCTTTGCGGTCGGTCAAAGA
Atu2283 paz -93 4 CATTTGATTTTTCGCAAAGA
Atu0767 ctaC -178 4.2 GGATTGATCAATGGCAAAAT
Atu1537 ccoN -131 5.5 TTCTTGATCTGGATCAAGGT
Atu1530 ccoG -72 5.2 CACTTGATGTAAGTCAAGGA
Atu0767 ctaC -71 5.1 TGATTGATCTAGATCAGACG
Atu0769 ctaB -209 3.8 GCCTTTATGAAAAGCAAGCG
Atu1268 nuoA -164 4.1 ATATTGTTGCCAATCAATGC
Atu3191 ompW -140 4.9 CATTTGATCCATCTCAATCG
Atu0626 adhA -93 4.1 GATTTGCGATGGGTCAATTC
Atu2613 hemA -166 5 TTTTTGATGTGAATCAATTT
Atu4088 cydR -92 4.7 ATTTTGACGCAGGTCAAAAA
Atu0973 ccmI -148 5.2 AGTTTGACGTAAATCAAGGT
Atu1602 fnrN -208 4 TATTTGCCTTTTATCAAGAA
Atu1602 fnrN -144 4.9 ACTTTGACTTCAATCAAATT
Azorhizobium caulinodans ORS 571
AZC_0334 hemA -84 4.7 CACTTGATCGAGCGCAAGGG
AZC_4523 ccoN -93 5 CCTTTGACTTGTATCAAGGT
AZC_3742 ompW -61 5.5 GATTTGATCTAGGTCAAACT
AZC_0320 adhA -175 5.3 GCGTTGATCCGCATCAAGCA
AZC_0320 adhA -67 5.5 AGCTTGATGCGGATCAAGGT
AZC_0581 cydR -55 5.1 AGGTTGCTCCAGATCAAACC
Bradyrhizobium japonicum USDA 110
blr7089 nirK -77 4 AGCTTGTTGCAGCGCAAACA
bsr3073 bsr3073 -41 4.5 GATTTGTCCGGGATCAATGA
bsr3073 bsr3073 -104 5.2 TCATTGACGCGGATCAATTG
blr2763 ccoN -73 4.8 ATCTTGATTTCAATCAATTC
bll6073 phbC -149 5.2 GGTTTGACTCAGGTCAAGCG
bll6073 phbC -84 4.7 GATTTGATGCAGCTCAACAC
bll3998 attK -123 4.8 CGATTGACCTGTCTCAAAGT
bll1200 hemA -150 5.4 TCTTTGATCGGGATCAAGTT
blr7961 hspC2 -85 4.8 AATTTGAGACAAATCAAGGA
blr4655 ppsA -50 4.9 AGGTTGACCTGCCTCAAGGC
blr2767 ccoG -74 5.3 CGTTTGAGCTGGATCAACGG
blr4637 hspC2 -89 4.9 GGCTTGAGCAAAATCAAATT
bll7086 hemN -105 3.8 ACTTTGCGCGAGCGCAAGGT
bll2758 bll2758 -50 5 CGATTGAGCCAAGTCAAGGC
bll2758 bll2758 -3 4 AGCATGATCGAGGTCAGTTC
blr3521 null -76 4.6 GCCTTGATTTGGCTCATACG
bll1766 ompW -231 4.8 TATTTGATTGGTATCAAATC
blr1311 ompW -63 5 GATTTGATCGGCGTCAAATC
bll5655 adhA -72 4.9 GGTTTGACTCCAATCAAGGG
bsr7036 napE -104 5.5 GGATTGATCCAGATCAACGC
blr0314 nosR -134 4.9 AGCTTGATCCAGCGCAAACA
bll6061 aadR -103 5.3 GAATTGATCTGGGTCAACCG
blr6062 blr6062 -75 5.3 CGGTTGACCCAGATCAATTC
blr6070 adhP -81 4.7 GCATTGAGGGAGGTCAAGGA
Bradyrhizobium sp. BTAi1
BBta_6826 nirK -84 3.9 TGCTTGTTGCAGCACAAACA
BBta_3527 hspC2 -153 5.2 CATTTGATCGTGATCAATCT
BBta_3690 RPA1090 -133 4.7 CCATTGACATAGCTCAACCG
BBta_6824 hemN -88 4.7 GCTTTGAGCAGGCTCAAGGC
BBta_2795 ccoG -86 5.1 CAATTGAGCTGGATCAACTG
BBta_5758 null -109 5.3 GAATTGACCCAGGTCAAAGG
BBta_2792 ccoN -100 5.2 AACTTGATTTCGATCAATTC
BBta_5758 null -75 5.1 TCATTGATGCAGCTCAAGGC
BBta_3726 bsr3073 -90 4.9 CGGTTGTTCCAGATCAATGA
BBta_2733 mhpA -52 5.8 CCTTTGATCCAGATCAAGCG
BBta_6404 bchE -76 5.3 CGTTTGAGCCAGATCAATTT
BBta_6824 hemN -161 4.1 ACTTTGAGGAAGCGCAAAGT
BBta_2787 bll2758 -84 5.4 GGATTGAGCTAGATCAAGCG
BBta_0946 ompW -108 5.4 CGATTGATCGAGATCAAATC
BBta_5308 adhA -70 4.6 CTTTTGATACCGATCAAGAC
BBta_1864 napE -103 5.2 GCCTTGATCCACGTCAACGC
BBta_6007 nosR -182 4.7 TGTTTGATCCAGCGCAACGT
BBta_6481 ppsA -76 4.4 CGCTTGATCTTCCGCAAGTC
BBta_5746 aadR -82 5.2 CATTTGATTTGAATCAATCG
BBta_5747 blr6062 -77 5.2 CGATTGATTCAAATCAAATG
BBta_5755 adhP -75 4.8 ACCTTGACAGACATCAAGCC
BBta_0828 ctaC -181 4.2 GCATTGCGATAGATCAAGAA
Brucella melitensis 16M
BMEII0988 nirK -188 3.7 CCTTTGTCTTAACGCAAACA
BMEII0988 nirK -95 4.6 ATATTGATTGCGGTCAAGGA
BMEI1564 ccoN -108 5.5 TGTTTGATTTAGATCAATGA
BMEI1294 fnrN 19 4.2 CATTAGATCAGAATCAAAAG
BMEI0454 ompW -108 5.5 TCTTTGATTTGGATCAATGG
BMEI1746 adhA -145 4.2 GCATTGCGTCTAATCAAGGA
BMEI0925 adhA -85 4.6 CTCTTGACGGAAATCAACGC
Mesorhizobium loti MAFF303099
mll6630 ccoN -96 5.5 GCTTTGACCTGGATCAAGGC
mll6626 ccoG -129 5.1 GGATTGACCTGCATCAACGC
mlr6415 ccoG -145 4.8 CGATTGACCTGCAGCAAGGC
mlr7688 ccmI -98 5.2 CGGTTGATGTCGATCAAGGA
mll6632 fnrN -103 5.1 GCCTTGATTTCGGTCAAAGC
mlr6409 fnrN -102 3.8 GCCCTGATTTCGGTCAGCCT
Mesorhizobium sp. BNC1
Meso_2243 nirK -176 4.7 ACTTTGATCCAGCGCAACGT
Meso_2243 nirK -83 4.3 TATTTGCGCCAGAGCAAAGA
Meso_4273 nirK -87 4 CGTTTGCGCCAGCGCAAAGA
Meso_2250 ccoN -90 5.1 GATTTGATCCAGAGCAAAGT
Meso_1022 nuoA -136 4.1 GGTTTGACTTGCGTCACCGA
Meso_2247 null -166 4.6 ACATTGTCCTGAATCAAATC
Meso_2264 osmY -131 4.7 GCTTTGATGAGCATCAACAT
Meso_2264 osmY -94 4.8 GCGTTGACGCCGATCAACGC
Meso_2276 hspC2 -256 4.7 AAGTTGACGCACGTCAATGC
Nitrobacter winogradskyi Nb-255
Nwi_0761 ctaC -196 4.5 TGTTTGATACAGCGCAAAGA
Nwi_0242 hemA -141 4.3 CATTTGCGCCAGAGCAAATT
Nwi_1034 blr6062 -139 5.3 CGATTGATCCAAATCAAGAT
Nwi_1034 blr6062 -77 5.1 GCCTTGACCTAAGTCAACGA
Rhizobium etli CFN 42
RHE_PF00507 ccoN -373 5.2 TTGTTGATGTAGATCAAGGA
RHE_PF00525 nirK -118 3.7 ACTTTGTGCCGGCACAAACA
RHE_PF00525 nirK -95 4.5 AGTTTGCGCCACGTCAAAGA
RHE_PF00503 ccoG -70 5.3 TTCTTGATCTGCATCAAGGA
RHE_PD00292 ccoG -69 5.3 TTCTTGATCTGCATCAAGGA
RHE_PD00292 ccoG -209 5.2 AGTTTGATCTGCCTCAAAGA
RHE_PD00296 ccoN -105 5.2 TTGTTGATGTAGATCAAGGA
RHE_PD00216 fnrN -145 5.6 GATTTGATCTGGATCAAATC
RHE_PC00106 adhA -147 4.2 GCTTTGGCCGGCGTCAAGCT
RHE_PF00489 hemA -238 4.7 TCTTTGATCGAAAGCAATCC
RHE_PF00489 hemA -69 5.1 AACTTGACGGAGATCAAATA
RHE_PD00022 osmY -75 5.2 TGCTTGATGAAGATCAACGA
RHE_CH02479 fnrN -110 5.5 TCTTTGATCTGAATCAAATT
RHE_CH02479 fnrN -79 4.6 CATTTGATAATCATCAAACT
RHE_PF00508 fixKf -152 5.2 TCCTTGATCTACATCAACAA
RHE_PF00498 ccmI -70 4.8 AATTTGACCGGCGTCAATGT
RHE_PD00216 fnrN -113 4.6 AAATTGATAGCCATCAAAGA
RHE_CH00952 ctaC -177 4.1 CGTTTGAGCCAACACAATGC
Rhizobium leguminosarum bv. viciae 3841
RL3726 sinR -96 4.9 CCGTTGACCAAAATCAATTC
pRL100208 ccoG -69 5.3 CTCTTGATCTGCATCAAGGA
pRL100208 ccoG -218 5 AGTTTGACCTGCCTCAAAGA
pRL100205 ccoN -96 5.2 TCGTTGACGCAGATCAAGGC
pRL90018 ccoN -96 5.2 TTGTTGATGTAGATCAAGGA
pRL90015 ccoG -241 4.8 AGTTTGACCGGTGTCAAGGA
pRL90015 ccoG -69 5.3 TTCTTGATCTGCATCAAGGA
pRL90039 COG2187 -60 5 TCATTGATGCGCGTCAATGC
pRL90027 adhA -79 4.2 GCTTTGCGATGAATCAATGC
pRL90008 hemA -70 5.3 AACTTGATCAGGATCAATTA
RL1876 adhA -65 5.2 TGTTTGACCGGGATCAAGTC
RL1878 osmY -75 5.2 TGCTTGATGAAGATCAACGA
pRL90275 cydR -75 5.1 GATTTGACCCAAGTCAAATT
RL2818 fnrN -135 5.7 GCTTTGATCTAGATCAAACA
RL2818 fnrN -103 4.2 AAATTGATAATCCTCAAGCG
pRL90019 fixKf -121 5.2 TCCTTGATCTACATCAACAA
RL1883 hspC2 -87 4.7 GCCTTGTCCCAGGTCAATCC
RL1883 hspC2 -31 4.8 GATTTGACGGTGATCAAAGA
Rhizobium sp. NGR234
NGR_c09980 paz -92 4.7 TGTTTGACAGACATCAAAGA
NGR_c09950 nirK -196 3.6 TCTTTGACAATTGGCAAAGA
NGR_c09950 nirK -92 4.5 TATTTGTTCCACCTCAAAGA
NGR_c09830 Atu8040 -64 4.7 TCTTTGCGCTTGATCAAAGA
NGR_c17990 ccoN -115 5.5 ACCTTGATCTGAATCAAGGC
NGR_c17930 ccoG -79 5.3 GACTTGACGCAGATCAAGGT
NGR_a02570 ompW -100 5.1 CGGTTGATCTCGATCAATAT
NGR_c03790 adhA -21 5 ATCTTGATGGAGGTCAAGGG
NGR_c09990 napE -130 4.7 TAATTGACGAAAATCAATTT
NGR_c30700 hemA -156 5.2 TGCTTGACTTCGATCAAAGT
NGR_c18100 fnrN -162 5.5 TTTTTGATCTGGATCAAGTG
NGR_c18100 fnrN -123 3.7 AAATTGACATTCGTCAGTTC
NGR_c05230 ctaC -38 5.5 GGTTTGATCCTGATCAAGCG
Rhodopseudomonas palustris CGA009
RPA4145 nirK -85 3.9 AGCTTGTGCTGGGACAAACA
RPA1006 mhpA -69 4.9 TATTTGACGCACGTCAAATA
RPA1505 hemC -243 4.5 CTTTTGACCTTGCTCAATAT
RPA1505 hemC -143 4.4 GAATTGTCCGAGATCAACGA
RPA4242 COG2187 -149 5.2 GAATTGATCAAGGTCAAACC
RPA0019 ccoN -79 5.1 ATTTTGATTTCGATCAAACG
RPA0854 hemA -169 5.2 GCATTGATCTTCATCAAGCC
RPA0657 badD -120 5.4 AATTTGATCCGCATCAAATT
RPA0260 RPA0260 13 5 GTTTTGATCCAGAGCAAAGA
RPA0746 mtrA -234 5.4 TAATTGATCTCGATCAAATA
RPA4241 COG2524 -161 5.2 GGTTTGACCTTGATCAATTC
RPA4243 phaC -235 5 GGCTTGAGCAAGGTCAAGCG
RPA1014 bsr3073 -58 5.7 CGTTTGATCCAGATCAAACT
RPA2339 irr -70 4.5 GATTTGACTGCGGTCAATTC
RPA2339 irr -188 5.3 TCCTTGATGCACATCAAATG
RPA1668 bchE -71 5 CGTTTGATCTGCGTCAACAA
RPA1224 iorA -100 4.4 CCGTTGACTTAGCGCAAATA
RPA1224 iorA -173 4 GAATTGACTCAGCACAAAAG
RPA0670 hbaB -65 4.4 TGCTTGACTTTGGTCATGGA
RPA3015 phyB1 -119 4.2 CTCTTGATCTTGCGCAAAAC
RPA1525 pufB -451 4.6 GATTTGAGCTAGAACAATGC
RPA4694 COG3181 3 4 AGCTTGATCCGACGCATTGT
RPA4249 bll2758 -92 4.8 GGATTGAGACAGATCAATCC
RPA4645 cbbF -221 4 CTTCTGATCTAAATCACGGC
RPA4264 nuoA -130 5 GAGTTGATCCGCGTCAACCA
RPA4462 null -107 4.7 CGGTTGCGCCAGATCAATGT
RPA4502 ompW -98 5.6 CATTTGATCCAGATCAAATC
RPA1919 ccmI -157 5.3 CCTTTGATTCAAATCAAGTT
RPA1090 RPA1090 -72 5.2 CGGTTGATCAAGATCAACTG
RPA4234 aadR -127 5.2 ACCTTGATCTGTGTCAAGCT
RPA4235 blr6062 -21 5.2 AGCTTGACACAGATCAAGGT
Sinorhizobium meliloti 1021
SMa1250 nirK -192 3.6 TCTTTGACAATTGGCAAAGA
SMa1250 nirK -91 4.5 TGTTTGTTCCACCTCAAAGA
SMa1243 paz -92 4.7 TATTTGACAAGCATCAAAGA
SMa1220 ccoN -109 5.7 CACTTGATCTGGATCAAGGT
SMa1211 ccoG -82 5.3 GACTTGACGCAGATCAAGGT
SMa1296 adhA -126 4.9 TCTTTGATGCCCGTCAAGGA
SMa1241 napE -131 4.7 TAATTGACGGAAATCAATTT
SMc03104 hemA -291 4.3 TGCTTGACTTCGATCGATGT
SMa1179 nosR -83 4.7 AAGTTGATCTGGCGCAAAGA
SMa1118 hspC2 -172 4.9 TCTTTGACGCCGGTCAATGA
SMc00009 ctaC -38 5.5 GGTTTGATCCTGATCAAGCG
Xanthobacter autotrophicus Py2
Xaut_0459 ccoN -97 5.2 GCTTTGACCTGTATCAAGGA
Xaut_3275 bsr3073 -72 4.3 CAGTTGATCGTTGTCAAAAG
Xaut_2126 hemA -108 4.4 CTCTTGATTGGTATCAATAC
Xaut_0669 adhP -107 5.1 CGGTTGACCCGCATCAATGC
Xaut_1968 ompW -87 4.9 AAATTGACATAAATCAAACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD