Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IdeR in Clostridia-3

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: IdeR - Clostridia-3
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Blautia hansenii DSM 20583
BLAHAN_00185 null -67 6.4 AAAATTAGTATAAACTAACTTT
BLAHAN_00186 feoB -38 4.4 TGAGTTAGCATGAACTAATTGA
BLAHAN_03143 PF10087 -99 4.8 GTAGTTAGTTAAAACTAATCAA
BLAHAN_03143 PF10087 -38 4.5 TAAGTTAGATAAGACTAATCAA
Bacteroides pectinophilus ATCC 43243
BACPEC_02631 ideR -135 4.5 ATGATTAAATTATGCTAAACAA
BACPEC_02635 null -72 5.9 GTAATTAGAATAAACTAACAAT
BACPEC_02120 null -44 4.8 AAGGTTAGTTATAACTAACTAA
Bryantella formatexigens DSM 14469
BRYFOR_00504 null -229 4.7 AAAAATAGCGTATACTAGTAAA
BRYFOR_00504 null -209 5 AACGTTAGAGACTTCTAACTGT
BRYFOR_03558 null -82 6.2 AATGTTAGCATATACTAACTTC
BRYFOR_01110 PF10087 -166 5.7 ACAGTTAGCATAAGCTAACTTA
BRYFOR_01110 PF10087 -99 5.1 TAGGTTAGGAAAAACTAACTTA
BRYFOR_03081 eno -100 5.6 AAAGTTAGTTAAAACTAACTAA
BRYFOR_00595 COG1132 -52 5 GGAGTTAGAAAATACTAACCCC
Clostridiales bacterium 1_7_47_FAA
Cbac1_010100022172 ideR -140 4.5 ATGGTTAGTTATTTCTAACTTC
Cbac1_010100004977 null -80 4.3 GCAGTTAGGATACCATAACTTT
Cbac1_010100015165 fur -216 5.2 ATAGTTAGCGTAAACTTACTGA
Cbac1_010100015165 fur -65 4.3 ATGGTTAGTCAAAACTATTTCA
Cbac1_010100005502 PF10087 -105 5.8 ATAGTTAGTCAATACTAACCAT
Cbac1_010100027059 null -54 5.1 TAGGTTAGCTTAAACTAACTGA
Cbac1_010100004917 eno -161 5.2 TTAGTTAGTAATAACTAACTTT
Cbac1_010100028374 COG1132 -70 4.5 TTCGTTATAATACACTACAGTT
Cbac1_010100028374 COG1132 -54 5.7 ACAGTTAGTAAAATCTAACTAT
Cbac1_010100025382 COG0426 -105 4.8 TGAGTAAGTGTACACTAAATAA
Clostridium bolteae ATCC BAA-613
CLOBOL_01420 ideR -91 4.3 CAGATTAGCACTTTCTAACTCT
CLOBOL_05596 ideR -140 5.2 ATGTTTAGTGTATGCTATCTTT
CLOBOL_00284 ideR -193 4.4 AAAGTTATGGTATCCTAACTGC
CLOBOL_05595 null -210 4.8 GATGTTAGAAAAATATAACTAA
CLOBOL_05595 null -104 5.7 AAAGATAGCATACACTAAACAT
CLOBOL_05594 feoB -51 5 ATAGTTAGCGAAAGCTAATGAA
CLOBOL_05594 feoB -31 4.3 AAAATAAGAAAAATATAACAAG
CLOBOL_00283 null -81 4.3 GCAGTTAGGATACCATAACTTT
CLOBOL_00460 COG0426 -107 5.4 ATTATTAGTGTACACTAATTTA
Clostridium nexile DSM 1787
CLONEX_01968 ideR -139 6 ATGGTTAGTATACTCTAACGTT
CLONEX_01967 null -65 6.5 AACGTTAGAGTATACTAACCAT
CLONEX_01965 feoB -58 4.9 ATGGTTAGTTAAAACTAATAAA
CLONEX_01942 null -32 4.9 TAAGTTAGAAATAACTAACTCA
CLONEX_02589 PF05031 -63 5.1 CTGGTTAGTTTAATCTAACAAA
Clostridium scindens ATCC 35704
CLOSCI_00926 ideR -161 5.5 GTAGTTAGTATATTCTCATCAT
CLOSCI_00925 null -101 5.8 ATGATGAGAATATACTAACTAC
CLOSCI_00924 feoB -71 6.1 TACGTTAGTATATACTAATTAA
CLOSCI_00921 null -171 4.4 ACAGTTAGCATTGACTATCTGA
CLOSCI_00929 null -65 4.4 ATAGTTAGTCGCAACTAATAAT
Ruminococcus lactaris ATCC 29176
RUMLAC_02635 ideR -139 4.1 AATTATAACATAATCTATCAAT
RUMLAC_01079 null -132 6 CACGTTAGCGTATACTAACTAA
RUMLAC_01088 PF10087 -77 5 TGAGTTAGAAAAGACTAACTAA
RUMLAC_01886 eno -107 5.7 ATGGTTAGTTAATACTAACTAT
Ruminococcus gnavus ATCC 29149
RUMGNA_03680 ideR -102 6.1 TTAGTTAGTATATTCTAACATT
RUMGNA_03679 fur -85 6.6 AATGTTAGAATATACTAACTAA
RUMGNA_03652 PF10087 -54 4.7 AAGGTTAGTTACAACTAACAAA
RUMGNA_03923 eno -123 4.7 AAGGTTAGCGATAACTAACTGA
RUMGNA_02766 null -93 5.7 ATGATTAGAATAAACTAATAAA
RUMGNA_02766 null -36 5.4 ATAGTTAGCGAAAACTAACTTG
RUMGNA_02768 PF05031 -130 4.3 ATAAGTAGAATCTTCTAAAACA
RUMGNA_02771 COG0609 -135 4.3 AACGATAAAGTGTACTATCTTA
Roseburia intestinalis L1-82
ROSINTL182_04350 null -71 6.7 AACGTTAGAATATACTAACCAA
ROSINTL182_04347 feoB -121 5 GGCGTTAGCAAATGCTAACAAA
ROSINTL182_04597 null -89 6.2 AAAGTTAGTGTAATCTAACTAT
ROSINTL182_04597 null -24 5.4 GGAGTTAGGATAAACTAACTAT
ROSINTL182_04596 COG0716 -133 4.5 TACAAAAGCATATTCTATCATT
ROSINTL182_03016 eno -55 5.4 ATAGTTAGACAAAACTAACAAT
Eubacterium rectale ATCC 33656
EUBREC_2328 ideR -180 5.8 ATAGTTAGTATACACTAACGCG
EUBREC_1581 null -130 5 AAAGTAAGAAAAATCTAAAAAA
EUBREC_1581 null -90 5.4 CACGTTAGAGTATACTAACACC
EUBREC_1583 feoB -59 5.4 TAGGTTAGTAAATACAAACTAT
EUBREC_1233 null -53 4.4 CTTGTAAGTAAACTTTAACTAT
EUBREC_2823 eno -112 5.4 TTAGTTAGATTAAACTAACTGT
Eubacterium eligens ATCC 27750
EUBELI_00572 null -29 5.8 ACCATTAGAATATACTAACCGA
EUBELI_00574 feoB -89 5.4 CAGGTTAGCATAATCTAATTAA
EUBELI_00569 PF10087 -112 4.9 ATAGTTAGTTAAAGCTAACTGA
EUBELI_01395 eno -176 4.3 AATTTATGTGTATACAAACTAA
EUBELI_01395 eno -55 5.9 AAAGTTAGAAGAAACTAACTTA
Dorea longicatena DSM 13814
DORLON_00345 ideR -156 6.3 ATAGTTAGTATATGCTAACGTT
DORLON_00346 null -120 6.7 AACGTTAGCATATACTAACTAT
DORLON_00403 PF10087 -48 4.9 TTAGTTAGATAAAGCTAACTAA
DORLON_00359 eno -108 4.4 AAAGATATGATATGCTGACGAT
DORLON_00359 eno -88 6.4 ATAGTTAGAATAATCTAACTAT
Dorea formicigenerans ATCC 27755
DORFOR_03080 COG1132 -55 4.8 GTGGTTAGATTAAGCTAACCCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD