Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GulR in Xanthomonadales

Properties
Regulator family: LysR
Regulation mode:
Biological process: Galactarate utilization; Glucarate utilization
Effector:
Regulog: GulR - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC3245 kdgD -101 5.6 ATCGATTCAATTTATGTATCAAA
XCC3246 gulR -219 5.6 TTTGATACATAAATTGAATCGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD