Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GulR in Ralstonia

Properties
Regulator family: LysR
Regulation mode:
Biological process: Glucuronate utilization; Galacturonate utilization; Galactarate utilization; Glucarate utilization
Effector:
Regulog: GulR - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia pickettii 12J
Rpic_4452 kdgD -106 6.4 ATCAATACAAGTTCTGTATTAAT
Rpic_4452 kdgD -341 6.2 ATCGATTCAAAAACGGTATGGAT
Rpic_4453 gulR -256 6.4 ATTAATACAGAACTTGTATTGAT
Rpic_4453 gulR -21 6.2 ATCCATACCGTTTTTGAATCGAT
Ralstonia solanacearum GMI1000
RS05369 kdgD -109 6.4 ATCGATTCAAAAAATGAATTGAT
RS05371 uxuL2 -111 6.1 ATCGATTCAAAACGTATATCGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD