Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GulR in Rhizobiales

Properties
Regulator family: LysR
Regulation mode:
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Regulog: GulR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azorhizobium caulinodans ORS 571
AZC_2640 gudP -304 5.5 ATCAATCCAAAAAATGGAATGAT
AZC_2638 kdgD -70 5.4 ACTGATCCCAAAAACGCATCGAT
Bradyrhizobium sp. BTAi1
BBta_6485 gudP -105 6.2 ATCAATCCAATAATTGGATCGAT
BBta_6486 gulR -21 5.1 ATCCATGCCGGGGAGGCATCGAT
BBta_6487 kdgD -141 5.2 ATTGATACCGACCCAGCATCAAT
BBta_6297 uxuF -103 5.9 ATCAATACCGATCCTGCATCGAT
BBta_0128 uxuP -183 6.2 ATCGATGCAAGTCTTGCATTGAT
Bradyrhizobium japonicum USDA 110
bll6551 uxuP2 -130 5.7 ATCCATACCTGAATTGGATCGAT
bll6551 uxuP2 -151 4.8 ATCAATCTGCGTTCGGCATTGAT
blr5869 gudP -107 6.1 ATCAATCCAAAAACGGCATCGAT
blr5870 gulR -21 5 ATTCATCTAAGGCATGTATCGAT
blr5871 kdgD -128 5.4 ATTGATGCTGATTTCGCATCGGT
blr0368 uxuF -42 5.8 ACCGATACCATTTCGGCATCGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD