Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AmtR in Streptomycetaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_6700 amt1 -54 7.7 AATTTCTGTCGGGCGACAGAAATC
SAV_6709 uctT -35 7.7 AATTTCTGTCGCCCGACAGGAACT
SAV_6701 amtR -155 7.9 GATTTCTGTCGCCCGACAGAAATT
Streptomyces scabiei 87.22
SCAB_73751 uctT -78 7.9 AATTTCTGTCGCCCGACAGGAATT
SCAB_73671 amtR -156 7.9 GATTTCTGTCGCGCGACAGAAATT
SCAB_73661 amt1 -126 7.9 AATTTCTGTCGCGCGACAGAAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD