Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Nocardiaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodococcus erythropolis PR4
RER_59770 mntC -55 5.2 ATTGTTCGGCTATACGAACTTG
RER_51720 mntH -74 6.1 AAAGTTCGGCTCCCCGAACTCT
RER_01640 sodA -191 5.9 TAAGTTCGGTTAACCAAACTTT
Nocardia farcinica IFM 10152
nfa24340 mntC -35 5.6 AAAGTTAGGGCGTCCGAAAATT
Rhodococcus opacus B4
ROP_70570 mntC -52 5.5 TGGTTTCGGTGAACCGAACATT
ROP_51290 mntH -78 5.3 AAAGTTCGTGGTACCTAAATCT
ROP_38900 sodA -189 5.8 TTTTTTCGGGTGCCCGAACTTT
Rhodococcus sp. RHA1
RHA1_ro07271 mntC -60 5.5 TGGTTTCGGCAAGCCGAACATT
RHA1_ro05067 mntH -77 5.2 AAAGTTCGCCATACCTAAATCT
RHA1_ro04009 sodA -189 5.8 TTTTTTCGGGTGCCCGAACTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD