Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PaaR in Streptomycetaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces coelicolor A3(2)
SCO7471 paaA -157 5.6 CCCGACCGACCATTCGGTTAGC
SCO7470 paaI -152 5.5 CCCAACCGACCATTCGTTCGGT
SCO3835 paaZ -106 5.8 CCCGACCGATCGTTCGGTTACT
SCO3834 paaH -74 5.8 AGTAACCGAACGATCGGTCGGG
SCO3831 bkdA -78 5.6 GACGACCGAACAATCGGTAGGT
SCO7471 paaA -34 5.5 ACCGAACGAATGGTCGGTTGGG
SCO7470 paaI -29 5.6 GCTAACCGAATGGTCGGTCGGG
Streptomyces avermitilis MA-4680
SAV_4358 paaZ -96 5.8 CCCGACCGATCGTTCGGTTACT
SAV_4362 bkdA -77 5.6 GACGACCGAACAATCGGTAGGT
SAV_1257 paaK -56 5 GGCTACCGAATGATCGGTCGCC
SAV_4359 paaH -74 5.8 AGTAACCGAACGATCGGTCGGG
SAV_4354 paaA -48 5.8 ACCGAACGATCGGTCGGTCGGT
Streptomyces scabiei 87.22
SCAB_82281 paaA -34 5.2 CCCGAACGAATGGTCGGTTGGG
SCAB_45351 paaZ -155 5.8 CCCGACCGATCGTTCGGTTACT
SCAB_45341 paaH -74 5.8 AGTAACCGAACGATCGGTCGGG
SCAB_45311 bkdA -77 5.9 AACGACCGAACAATCGGTAGGT
SCAB_82281 paaA -166 5.5 GCCGACCGACCATTCGGTTGCT
SCAB_82261 paaK -184 5.2 CCCAACCGACCATTCGTTCGGG
SCAB_82261 paaK -52 5.5 AGCAACCGAATGGTCGGTCGGC
Streptomyces griseus subsp. griseus NBRC 13350
SGR_3741 paaA -34 5.6 AGGAACCGAACGATCGGTCGGT
SGR_3745 paaZ -72 5.8 CCCGACCGATCGTTCGGTTACT
SGR_6814 paaK -77 5.4 ATCGACCGAATGATCGGTCGCC
SGR_3746 paaR -106 5.8 AGTAACCGAACGATCGGTCGGG
SGR_3748 bkdA -127 5.5 CGCGACCGAACAATCGGTAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD