Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Listeriaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin1463 mntH -51 6.4 AATGTTTCCCGTAGTAAACTTT
lin1963 mntB -68 6.3 AAAGTTGCATTAAGGAAACATT
Listeria monocytogenes EGD-e
lmo1424 mntH -51 6.4 AATGTTTCCCGTAGTAAACTTT
lmo1849 mntB -68 6.4 AAAGTTGCTCTAAGGAAACATT
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_1343 mntH -51 6.4 AATGTTTCCCGTAGTAAACTTT
lse_1829 mntB -69 6.4 AAAGTTGCTCTAAGGAAACATT
Listeria welshimeri serovar 6b str. SLCC5334
lwe1441 mntH -51 6.4 AATGTTTCCCGTAGTAAACTTT
lwe1868 mntB -68 6.4 AAAGTTGCTCTAAGGAAACATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD