Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Streptomycetaceae

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces scabiei 87.22
SCAB_41531 rpmF2 -64 5.1 TAATGGGATCCATTTTCATGT
SCAB_40011 rpmB2 -66 5.9 TACTGAAAATGAATTCCATTT
SCAB_40001 rpmG2 -31 5.9 AAATGGAATTCATTTTCAGTA
SCAB_61981 znuA -17 5.1 AGATGAAAATGACTGTCATGA
SCAB_61981 znuA -39 5 TGTTGACAATCGTTTCCAGAT
Streptomyces griseus subsp. griseus NBRC 13350
SGR_545 rpmB2 -58 5.6 ATATGGCAATGGTTTCCATTT
SGR_546 rpmG2 -31 5.6 AAATGGAAACCATTGCCATAT
SGR_5019 znuA -39 5 TGTTGACAATCGTTTCCACTT
SGR_5019 znuA -17 4.6 AGTTGAAAATGAGTGTCATGA
Streptomyces coelicolor A3(2)
SCO0436 rpmF2 -56 5 ACATGAACATCGTTTTCATGT
SCO0475 znuB2 -34 4.9 TGTTGAACATGATTTTCATTG
SCO3429 rpmB2 -62 5.9 TACTGAAAATGAATTCCATTA
SCO3428 rpmG2 -31 5.9 TAATGGAATTCATTTTCAGTA
SCO2505 znuA -17 4.6 TGTTGAAAATGAGTGTCATGA
SCO2505 znuA -39 5 TGTTGACAACGGTTTCCATAT
Streptomyces avermitilis MA-4680
SAV_5634 znuA -39 5.3 TGTTGACAATCGTTTCCAGTT
SAV_4642 rpmB2 -75 5.7 TACTGAAAACGACTTCCATTT
SAV_4643 rpmG2 -31 5.7 AAATGGAAGTCGTTTTCAGTA
SAV_5634 znuA -17 4.8 TGTTGAAAATGACTGTCATGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD