Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator QorR in Nocardiaceae

Properties
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Regulog: QorR - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodococcus erythropolis PR4
RER_15410 qorR -69 6.7 GCACTTATTTTTCGTAAGTGC
RER_15420 qorB -70 6.7 GCACTTACGAAAAATAAGTGC
Rhodococcus opacus B4
ROP_18560 qorR -66 6.6 GCACTAATTTTTCGTAAGTGC
ROP_18550 qorB -78 6.6 GCACTTACGAAAAATTAGTGC
Rhodococcus sp. RHA1
RHA1_ro02138 qorR -66 6.6 GCACTAATTTTTCGTAAGTGC
RHA1_ro02137 qorB -79 6.6 GCACTTACGAAAAATTAGTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD