Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArsR in Nocardiaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Regulog: ArsR - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Nocardia farcinica IFM 10152
nfa24490 arsR -13 6.5 TCAATATCGATGCATGTCTA
pnf2240 arsR -13 6.8 TCAATATTGGCGTATGTCGA
Rhodococcus erythropolis PR4
pREL1_0158 arsR -28 6.9 TCAATATTGATGTATGTCGA
RER_35210 arsR -13 6.9 TCAATATCGAAGAATGTCGA
Rhodococcus opacus B4
ROP_00150 arsR -13 7.2 TCAATATCGACGTATGTCGA
ROP_29950 arsR -13 7.1 TCAATATCGACGCATGTCGA
Rhodococcus sp. RHA1
RHA1_ro03367 arsR -13 7.1 TCAATATCGACGCATGTCGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD