Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Mycobacteriaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium smegmatis str. MC2 155
MSMEG_5589 mntH -53 6.8 GATTTCGGCTAACCTAACTT
MSMEG_5329 COG2119 -311 4.9 AGTATCGGTTACCCGAACAT
Mycobacterium marinum M
MMAR_4584 mntH -54 5.5 TGTTTCGGCTAGCCTCACTT
MMAR_5398 COG2119 -216 4.6 GGATACGGCCGCCCGAACTT
Mycobacterium flavescens PYR-GCK
Mflv_3168 mtsA -35 4.9 AGTTTCGGCGACCCGAAATC
Mflv_1822 mntH -54 6.1 GGTTTCGTCTGGCCTAACTT
Mycobacterium avium 104
MAV_1044 mntH -52 4.6 ATGTTCGACTACCCTCACTT
Mycobacterium abscessus ATCC 19977
MAB_1031c mntH -53 5.4 AGTTTCGGCTACTCTAACTT
Mycobacterium sp. JLS
Mjls_4747 mntH -51 6.7 GTTTTCGGCTAACCTAACTT
Mjls_5425 COG2119 -218 4.3 GAATACGGCTGTCCGAAAAC
Mycobacterium tuberculosis H37Rv
Rv3848 COG2119 -217 4.6 AAATACGGGTGGCCGAACTT
Mycobacterium vanbaalenii PYR-1
Mvan_3371 mtsA -61 5.3 GTTTTCGGTCACCCAAACTT
Mvan_4708 COG2119 -293 5.2 GTTTTGGGGTAGCCGAACTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD